TLR11 and 12 are demonstrated seeing that important receptors for acknowledgement

TLR11 and 12 are demonstrated seeing that important receptors for acknowledgement. proliferation, levels of cytokines, antibody titers and T lymphocyte subclasses were analyzed. The protective efficacy against chronic contamination was observed at 4?weeks post-infection with the cyst-forming PRU strain of (Genotype II). Results EitherpVAX-PF with or without pVAX-IL-15 could elicit higher level of IgG and IgG2a antibodies and produce strong cellular immune responses in the immunized mice. The brain cyst figures in mice Rabbit Polyclonal to ALK immunized with pVAX-PF?+?pVAX-IL-15 (1843??215.7) Aucubin and pVAX-PF (1897??337.8) were reduced 40.82% and 39.08%, respectively, compared to that in mice received nothing (3114??168.8), and the differences were statistically significant (cyst figures in mice immunized with pVAX-PF?+?pVAX-IL-15 were not statistically significantly different compared to that in mice immunized with pVAX-PF alone [t(10)?=?0.33, contamination. Keywords: can infect most all of warm-blooded animals and humans, which would lead to zoonotic toxoplasmosis worldwide [1, 2]. usually cause subclinical contamination in most of immunocompetent adults [3, 4], but the parasite would be a severely Aucubin risk factor for immunodeficient individuals (HIV-infected patients and transplant recipients), children and pregnancy [5C8]. is also a common cause of abortion in sheep and goats, leading to severe economic losses [6, 9, 10]. However, no effective treatment was available to eliminate cysts by now. Immunoprophylaxis against would be of high priority for the disease control, as previous reviews noted [10C12]. A number of vaccine Aucubin candidates, including surface antigens (SAG), rhoptry antigens (ROP), microneme antigens (MIC), dense granule antigens (GRA) and some other proteins playing important roles in the life cycle of have been evaluated against infectionHowever, no one can completely protect against tissue cysts, usually lower than 80C90% protection [11]. DNA-based vaccines were considered to elicit effective humoral and cell-mediated immunity against invasion in animal models, which have been used in many previous studies [11C13]. Following the parasite invasion, host immune response is usually successively suffered innate acute response and an Ag-specific cell-mediated immune response [14]. The invading parasite in mouse model is usually primarily recognized by Toll-like receptors (TLRs) of DCs, and then triggers the hosts TLRs/MyD88 response [15]. TLR11 and 12 are exhibited as important receptors for acknowledgement. Activation of TLR11 and 12 can induce potent cytokine responses, and lack of TLR11 and TLR12 genes, mice were showed rapidly succumb to contamination [16C18]. profilin (TgPF), one of the ligands of both TLR11 and 12, is essential for the parasite gliding motility, host cell invasion and egress from host cells in mice [17, 19]. TgPF is also shown to be an immunodominant antigen. Immunization of C57BL/6 mice with TgPF encapsulated in oligomannose-coated liposomes induces protective immunity against contamination with tachyzoites (PLK strain) [20]. DNA vaccination can deliver the expressed protein as an endogenous antigen, and has exhibited promise for defense against toxoplasmosis due to the ability of eliciting effective humoral and cellular immune responses in mice [11]. These findings stimulated to hypothesize whether the endogenous TgPF protein could induce effectively protective responses against contamination with tissue cysts, the primary transmission route of contamination for humans [2]. To examine the immunogenicity of the genetic TgPF antigen, we constructed a DNA vaccine encoding TgPF (pVAX-PF), and used a plasmid encoding murine costimulatory molecule IL-15 (pVAX-IL-15) as genetic adjuvant. The pVAX-PF DNA vaccine with or without pVAX-IL-15 were examined for their ability of eliciting immune responses and their protective efficacy against chronic contamination in a murine model. Methods Mice and parasites A total of 108 specific-pathogen-free (SPF) grade female Kunming mice aged six to eight weeks were purchased from Lanzhou University or college Laboratory Animal Center (Lanzhou, China). All mice were handled in rigid accordance with good animal practices according to the Animal Ethics Procedures and Aucubin Guidelines of the Peoples Republic of China. Tissue cysts of the low virulent PRU strain of (Genotype II) were preserved in State Key Laboratory of Veterinary Etiological Biology, Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences, Lanzhou, Gansu Province, China. The cysts of the PRU strain were obtained from the brains of orally infected Kunming mice one month after intragastric administration of the cysts. Expression of TgPF protein in bradyzoites using E.Z.N.A. Total RNA Kit I (Omega, America). The complete open reading frame (ORF) of TgPF gene was amplified by reverse transcription-polymerase chain reaction (RT-PCR) using a pair of specific primers (prfF: 5- CGG GGTACC ATGTCCGACTGGGACCCTGTTGTCAAGG -3, Aucubin prfR: 5- CCG GAATTC TTAGTACCCAGACTGGTGAAGATACTCG – 3), designed according to the corresponding sequence of.